La mojarra tenguayaca (Petenia splendida) es una especie de cíclido carnívoro con excelente valor comercial en el sureste de México. A pesar de su potencial para la acuicultura, existe muy poca información sobre sus rutas metabólicas relacionadas con su nutrición, fisiología y reproducción. El presente estudio se enfoca en la expresión del transportador de glucosa (glut2) en embriones y larvas de 5, 10, 15, 20, 25 y 30 días post eclosión (dph) y en el hígado, intestino, riñón, músculo, corazón, testículo, branquias, estómago, páncreas y cerebro en peces adultos. Se diseñaron cebadores de qPCR específicos para glut2. La expresión en los embriones fue menor que en larvas a los 5, 15 y 20 dph. La expresión máxima en larvas se observó a los 20 dph y la mínima a los 25 y 30 dph. La expresión más alta en los adultos ocurrió en el hígado y el intestino. Nuestros resultados muestran que el gen glut2 se expresa de manera diferencial en los tejidos de adultos de la mojarra tenguayaca y su expresión fluctúa durante el desarrollo larvario.
Palabras clave: Expresión genómica, Ontogenia inicial, Peces adultos, Petenia splendida, Transportador de glucosa.
Introduction
The Bay snook Petenia splendida Günther, 1862 is a carnivorous freshwater cichlid species distributed from Southeast Mexico to Central America (Álvarez-González et al., 2008). This species possesses an excellent economical value and is widely accepted in local markets (Pérez-Sánchez, Páramo-Delgadillo, 2008). Additionally, it presents suitable characteristics for aquaculture, including high growth rate, tolerance to overcrowding, relative low time of production (~1 year) and its meat has high nutrimental content (Uscanga-Martínez et al., 2011). Various studies have described different aspects of P. splendida,such as its biology and physiology (Álvarez-González et al., 2008; Jiménez-Martinez et al., 2019), taxonomy and ecology (Méndez et al., 2011), aquaculture technology (Pérez-Sánchez, Páramo-Delgadillo, 2008; Vidal-López et al., 2009; Treviño et al., 2011, Jiménez-Martínez et al., 2019), nutrition and digestive physiology (Álvarez-González et al., 2008; Uscanga-Martínez et al., 2011; Rodríguez-Estrada et al., 2020), and cytogenetics (Arias-Rodriguez et al., 2008). However, there is gap in the understanding of nutritional metabolic pathways, especially for glucose. Glucose is a primordial energy source for most physiological processes and the correct functioning of various tissues such as the brain, liver, gonads, and muscle (Hemre et al., 2002; Deng et al., 2020). This molecule is absorbed in the gut by enterocytes through specific glucose transporters (Blanco et al., 2017). Two types of transporters for glucose and other monosaccharides have been described: 1) sodium-glucose transporters (sglt) mainly related to renal glucose reabsorption, and 2) glucose transporters (glut) which facilitates the transport of glucose across the plasma membrane via facilitated diffusion (Thorens, 2015; Bertrand et al., 2020). In mammals, 14 glucose transporters (glut1-14) have been described (Wood, Trayhurn, 2003; Scheepers et al., 2004; Mueckler, Thorens, 2013; Thorens, 2015; Holman, 2020) and each GLUT isoform plays a specific role in glucose metabolism depending on tissue expression patterns, substrate specificity, and the regulation of the expression under different physiological conditions (Wright Jr. et al., 1998; Castillo et al., 2009; Gómez-Zorita, Urdampilleta, 2012). In teleost fish, glut1 has been characterized in common carp (Cyprinus carpio) (Teerijoki et al., 2001b), grass carp (Ctenopharyngodon idella) (Li et al., 2018), rainbow trout (Oncorhynchus mykiss) (Teerijoki et al., 2000, 2001a) and Atlantic cod (Gadus morhua) (Hall et al., 2004); glut3 in grass carp, (C. idella) (Zhang et al., 2003) and Atlantic cod (G. morhua) (Hall et al., 2005); and glut2 and glut4 in Atlantic salmon (Salmo salar) (Menoyo et al., 2006) and Atlantic cod (G. morhua) (Hall et al., 2006, 2014). In the case of glut1-6, glut8-13 and glut15 are reported in the spotted sea bass (Lateolabrax maculatus) (Fan et al., 2019).
GLUT2 is considered the main isoform of glucose transporters in the liver, plays a role in regulating insulin, and removes excess glucose from the blood (Mueckler, Thorens, 2013). This molecule is involved in different processes, including intestinal and renal glucose absorption, stimulation of insulin secretion in pancreatic cells, and the glucose detection capacity in specific brain regions involved in the regulation of glucose and food metabolism (Castillo et al., 2009; Yan, 2017; Zhao et al., 2020). In fish, glut2 has been detected in different tissues (pancreatic cells, hypothalamus, pancreas, kidney, and liver), and its expression is related to feeding habits and nutrition in species such as zebrafish (Danio rerio), common carp (C. carpio), rainbow trout (Oncorhynchus mykiss), Nile tilapia (O. niloticus), blunt snout bream (M. amblycephala), grass carp (C. idella), and cobia (Rachycentron canadum) (Krasnov et al., 2001; Panserat et al., 2001; Castillo et al., 2009; Polakof et al., 2010; Liu et al., 2014; Liang et al., 2018; Deng et al., 2020; Zhao et al., 2020; Ye et al., 2020). In Atlantic cod (G. morhua), the expression of glut2 during larval development decreased with starvation because of changes in blood glucose (Hall et al., 2006). However, there is no available information regarding glut2 regulation during the larval development of the P. splendida. For this reason, this study examined the expression of glut2 in various organs of P. splendida adults and contributed to understanding the gene’s regulation and dynamics during the early ontogeny of this species.
Material and methods
Fish acquisition. Twenty male individuals of P. splendida (450–490 g and 20–25 cm) were obtained from the Tropical Aquaculture Laboratory, División Académica de Ciencias Biológicas, Universidad Júarez Autónoma de Tabasco, Southeast Mexico. Fish were kept in circular 2000-L polyethylene tanks and were fed the rainbow trout diet (45% protein and 16% fat, El Pedregal® Silver Cup, Toluca, Mexico) with particle diameters ranging between 5.5- and 9.0-mm. Embryos and larvae were obtained from simultaneous spawning from the broodstock kept in the same facility. Six females and three males were transferred from holding tanks to a 2000-L breeding tank. Six acrylic sheets (one side smooth, one side rough) were placed in each tank to provide shelter and egg-laying surfaces (rough side). Right after hatching, larvae were separated from the adults. After 3 days 150 larvae per tank were placed in three 70-L oval tanks with constant aeration (~95% air saturation), pH ~8.0, connected to an open system, at 28ºC, with water changes (80%) every two or three days. Larvae were fed satiety with brine shrimp (Artemia sp.) nauplii five times per day (at 8:00, 11:00, 13:00, 15:00, and 18:00 h) for 7 days (until 10 days post-hatching, dph). From 11 to 13 dph, larvae were provided with a co-feeding of Artemia nauplii and trout feed (Silver Cup; Nelson and Sons, Inc; proximate composition: 45% proteins, 16% lipids, 21% carbohydrates, 9–12% ashes) and from day 14 dph, larvae were only provided with trout feed until 30 dph. Food was provided at apparent satiation, and particle size was adjusted according to larval growth (250–500, 500–750, and > 750 m). Temperature (28.0 ± 0.7°C), dissolved oxygen (5.9 ± 0.6 mg/L), and pH (7.1 ± 0.3) Water parameters were constantly assessed with a YSI 85® Meter, YSI Inc., Yellow Springs, OH (temperature (28.0 ± 0.7°C), dissolved oxygen (5.9 ± 0.6 mg/L), and pH (7.1 ± 0.3).
Sampling. After males were euthanized by cold thermal shock (at -4°C) after 24 h of fasting. Fish were dissected in ice to obtain the liver, intestine, kidney, muscle, heart, testicles, gills, stomach, pancreas, and brain. Larvae were sampled on different days after hatching (10 larvae per tank): before first feeding, starting from the embryo (considered as 0 dph), and 5, 10, 15, 20, 25, and 30 dph. Larvae were removed from each tank, rinsed in distilled water, and transferred to Eppendorf tubes with 1.5 mL of RNA Later and stored at -80°C.
RNA extraction and cDNA synthesis. The RNA extraction was performed from tissues and pooled larvae (10) using the Trizol Reagent (Invitrogen, Carlsbad, CA) method under the manufacturer’s indications. One microgram of RNA was used for reverse transcription with iScript TM Select cDNA Synthesis Kit 170 – 8,896 (BioRad, Hercules, CA). Subsequently, 1 µL of cDNA was used for the end-point Polymerase Chain Reaction (PCR). To obtain the partial sequence of glut2, samples were run in a 96-well thermocycler using the Platinum Taq DNA Polymerase (Invitrogen, Carlsbad, CA). Amplification was conducted under the following conditions: 10 min at 95°C, followed by 35 cycles at 95°C for 30 s, 58°C for 30 s, and 72°C for 50 s with a 5 min extension at 72°C using specific oligonucleotides previously obtained from alignment (using Clustal‐W software, Infobiogen) of corresponding sequences available in the library from different species of cichlids including Nile tilapia (O. niloticus ACZ73587.1), Burton’s mouthbrooder (Astatotilapia burtoni XP_005926097) and zebra mbuna (M. zebra XP_004540234.1) (Tab. 1). The amplification products were separated in 1.5% agarose gel stained with ethidium bromide. Observed bands under UV light (Biorad® Model Universal Hood II, Hercules, CA) were cut from the gel and purified using the PureLink® PCR Purification Kit (Invitrogen). The purified bands were sent to the Synthesis and Sequencing Unit of the Institute of Biotechnology of the Universidad Nacional Autónoma de México (UNAM) to be sequenced.
Sequence analysis. Obtained partial sequences were edited and analyzed using ExPASy translation software to search for the open reading frame (ORF). Once the ORF was identified, it was translated to amino acid (AA) sequences using standard genetic codes. The nucleotide sequence was compared with DNA sequences from other fish available in the GenBank database network service at NCBI (https://blast.ncbi.nlm.nih.gov/Blast.cgi). Protein sequence alignments were performed by the multiple sequence alignment software BioEdit 7.2 (www.mbio.ncsu.edu/bioedit/bioedit.html). A phylogenetic tree was generated using neighbor-joining (NJ) methods based on the AA sequence using MEGA 7.0 software.
TABLE 1 | Oligonucleotides used for glut2 gene sequencing and q-PCRs in Petenia splendida.
| Primer name | Forward primer (5’-3’) | Reverse primer (5’-3’) | Size, pb | Step |
| GLUT2 | ATCATGTACTGGTCGTTGT
GGGCCGCATGATCCAACTAT
|
GTAATTTGAGGCCCACTGTCA
TGCATCATGAGGGCAACAAC
|
889
139
|
RT-PCR
qPCR
|
| 18S rRNA | GGACACGGAAAGGATTGACAG | GTTCGTTATCGGAATTAACCAGAC | 111 | qPCR |
Real-time polymerase chain reaction (q-PCR). The resulting cDNA from adult tissues, embryos, and larvae were diluted in 200 μL of distilled water. The quantitative polymerase chain reactions (qPCRs) were performed in a 96-well thermocycler CFX96 Real‐Time System Thermal Cycle (Model C1000, CA). The reaction mixture included 10 μL of Eva Green, 2 μL cDNA, and 0.2 μL of each primer (shown in Tab. 1). The thermal program included 2 min at 95°C, followed by 38 cycles at 95°C for 10 s, 60°C for 30 s, and extension at 70°C for 5 s. All reactions were performed by duplicates. The normalization of cDNA 18S rRNA was used as a constitutive gene and carried out in parallel with all samples, according to Wang et al. (2015) and Yang et al. (2013). A standard curve for each pair of primers was generated to estimate amplification efficiencies based on known amounts of cDNA (four serial dilutions corresponding to cDNA transcribed from 100 to 0.1 ng of total RNA). Relative gene expression of tissues and larval growth stages was calculated by the delta-delta copy threshold (CT) method (Pfaffl, 2001).
Statistical analysis. The relative expression of glut2 between the different tissues of adult P. splendida and the comparison between embryos and the different dph of larvae were analyzed using the Kruskal-Wallis test. A posteriori Nemenyi test was performed to determine significant differences between tissues (adults) and developmental time (embryos and larvae) (P ≤ 0.05). All statistical analyses were performed using the software STATISTICA TM v. 7.0 (StatSoft, Inc., Tulsa, OK.).
Results
FIGURE 1 | Partial sequence of nucleotides and amino acids (AA) encoding glut2 (glucose transporter 2) from Petenia splendida taken from Gen Bank to design specific oligonucleotides for qPCR.
PCR amplification and sequencing analysis. A partial sequence for glut2 of 889 bp encodes 296 AA was obtained and registered in the GenBank (accession number QKG31965.1, MN792759.1; Fig. 1). The alignment of P. splendida AA concerning other fishes exhibited conserved regions of glut2. Identity values were shown as 98.5 % for Nile tilapia (Oreochromis niloticus), 97.97% for zebra mbuna (Maylandia zebra), 93.24% for Burton’s mouthbrooder (Astatotilapia burtoni), 88.85% for Turquoise killifish (Nothobranchius furzeri), 93.58% for flameback (Pundamilia nyererei), 92.57% for princess cichlid (Neolamprologus pulcher), 90.20% for flier cichlid (Archocentrus centrarchus), 88.51% for yellow perch (Perca flavescens), 43.7% for zebrafish (Danio rerio), 43.6% for common carp (Cyprinus carpio) 43.5 % for blunt snout bream (Megalobrama amblycephala), 43.2 % for grass carp (Ctenopharyngodon idella) and 29.5% for rainbow trout (Oncorhynchus mykiss) (Fig. 2). According to the AA sequence of glut2, the phylogenetic three clusters P. splendida (bootstrap value of 74%) with the Nile tilapia (O. niloticus), blue tilapia, zebra mbuna (M. zebra), Burton’s mouthbrooder (A. burtoni), flameback (P. nyererei) and princess cichlid (N. pulcher) (Fig. 3).
FIGURE 2 | Amino acid sequence of glut2 in Petenia splendida aligned with other species other species of teleost fish. Identical amino acids are presented in black, and the high and less conserved amino acids are presented in gray and period, respectively.
FIGURE 3 | Phylogenetic tree based on the sequence of glut2 (glucose transporter 2) from Petenia splendida and other teleosts using the neighbor-joining (NJ) method. Values at branch points represent percentage frequencies for tree topology after 1,000 interations.
FIGURE 4 | Relative expression of glut2 in kidney (K), liver (L), muscle (M), brain (B), pancreas (P), gill (G), heart (H), intestine (I), stomach (S) and testis (T) of adult Petenia splendida (mean ± SEM; n = 3). Lowercase letters indicate significant differences between the expression level in the tissues (p < 0.05).
Relative expression of glut2 in P. splendida adults and larvae. The highest expression of glut2 occurred in the liver, followed by the intestine, kidney, and muscle, while the lowest was in the pancreas, gill, heart, brain, testicle, and stomach, respectively (P ≤ 0.05) (Fig. 4). On the other hand, glut2 expression in embryos and larvae as a function of developmental time showed high variation (Fig. 5). Embryos had higher expression than larvae at 10, 25, and 30 dph and lower expression when compared to larvae at 5, 15, and 20 dph (P ≤ 0.05). The highest expression of glut2 occurred in 20 dph larvae and the lowest in 25 and 30 dph larvae (Fig. 5).
FIGURE 5 | Relative expression of glut2 during the early ontogeny of Petenia splendida. Lowercase letters indicate significant differences in the expression of glut2 as a function of developmental time (p < 0.05). AN: Artemia nauplii (3–10 dph), CF: cofeeding (Artemia nauplii and tilapia feed) (11–13 dph), TF: trout feed (14–30 dph) (mean ± SEM; n = 3).
Discussion
Characterization and expression of glut2 in tissues from P. splendida adults. In the current study, the partial sequence of glut2 was isolated and identified from the liver of P. splendida. Amino acid alignment of glut2 showed a great identity and highly conserved regions among cichlids and other teleosts. These results are consistent with O. niloticus, M. amblycephala, and C. carpio, where glut2 contains 12 transmembrane domains (Liu et al., 2014; Liang et al.,2018; Deng et al., 2020). Moreover, the exact phylogenetic trend, including high values of convergence, is undeviating with results from Liu et al. (2014).
Furthermore, expression of glut2 was observed in all the analyzed tissues from P. splendida (liver, intestine, kidney, muscle, heart, testicle, gill, stomach, pancreas, and brain). The highest mRNA expression occurred in the liver, followed by the intestine and kidney. These results agree with studies in other teleosts, including O. niloticus (Liu et al., 2014), C. carpio (Deng et al., 2020), M. amblycephala (Liang et al., 2018), O. mykiss (Panserat et al., 2001; Krasnov et al., 2001), G. morhua (Hall et al., 2006) and European sea bass Dicentrarchus labrax (Terova et al., 2009). In addition, studies in mammals show that the highest expression of glut2 occurs in the liver, pancreas, intestine, and kidney (Karim et al., 2012; Thorens, 2015), which suggests that the patterns of glut2 expression are highly conserved within vertebrates. One possible explanation could be the similarity between the aminoacid sequences in fish and mammals, including humans (Krasnov et al., 2001; Castillo et al., 2009).
The increased expression of glut2 in the liver may occur since this organ is responsible for the synthesis, storage, and redistribution of glucose in the form of glycogen (Polakof et al., 2010; Karim et al., 2012; Liang et al., 2018). Furthermore, the intestine is a vital organ for glucose absorption, and its dynamics and mechanisms are critical endpoints in elaborating specific diets for cultured fish species (Thorens, Mueckler, 2010; Blanco et al., 2017; Zhao et al., 2020). In zebrafish, glut2 expresses in the brush border and basolateral membranes of the intestines. However, metabolic and endocrine factors regulate mRNA levels and the distribution of molecules of this gene to the apical membrane (Cheeseman, 2002; Castillo et al., 2009). In contrast, the expression of glut2 in the kidney has been detected in other species such as O. mykiss, D. rerio,and G. morhua (Krasnov et al., 2001; Panserat et al., 2001; Castillo et al., 2009; Hall et al., 2014), where they mention that the kidney is involved in the regulation of glucose homeostasis through 3 primary mechanisms: 1) the release of glucose into the bloodstream through gluconeogenesis, 2) the consumption of glucose to meet the renal energy needs, and 3) glucose reabsorption in the proximal tubule (Segura, Ruilope, 2013).
Expression of glut2 in embryos and larvae of P. splendida. In our study, glut2 expression was observed from the embryonic period. Expression in embryos could be attributed to zygotic gene activation during early development or maternal mRNA transference; however, details about gene activation in P. splendida zygotes are unknown. Fish energy reserves such as proteins, carbohydrates, and lipids are found in yolk and oil droplets in larvae, and their functions are namely structural and for the maintenance of metabolic pathways, which depend on both genetic and epigenetic factors (Burggren, Blank, 2009; Treviño et al., 2011; Lubzens et al., 2017). The low expression of glut2 in 5 dph larvae may be related to the poor differentiation of the digestive system, where the intestine is a straight tube (dorsally to the liver) connected directly to the esophagus (Treviño et al., 2011). Our results are consistent with previous reports in zebrafish, where glut2 expression is detected in 5 dph by foregut development anterior intestine (intestinal bulb), which plays an essential role in the absorption of glucose via facilitated diffusion occur, especially in the enterocytes of the luminal and basolateral membrane (Castillo et al., 2009; Polakof et al., 2010; Blanco et al., 2017). Therefore, Holmberg et al. (2004) mention that the efficiency of carbohydrate utilization in fish larvae depends on an adequate development of the digestive system and the concentration of this nutrient in live prey, which in the case of Artemia nauplii, ranges from 11 to 17% (Guevara, Lodeiros, 2003). For P. splendida larvae, the intestine is fully functional on day 5 dph when a regular movement pattern marks exogenous feeding is visible, being the moment where glut2 expression increases when the Artemia nauplii are provided. Similarly, to the results obtained with the cobia Rachycentron canadum larvae when they were fed with a diet rich in carbohydrates by the addition of rotifers and Artemia (Hall, 2006). In this sense, the regulation of several genes for carbohydrate metabolism in fish larvae is related to innate genomic expression and the external stimuli when the live prey is offered (Darias et al., 2006).
Expression of glut2 in P. splendida decreased at 10 dph and subsequently increased at 15 dph. The increment in glut2 expression could be related to the change in the diet (co-feeding). By 15 dph, larvae were fed with a balanced commercial diet, increasing the glucose intake using carbohydrates in the formulation. For example, wheat, soy, sorghum meals, and starch are used as binders (Kamalam et al., 2017). Uscanga-Martínez et al. (2011) mentioned that 15 dph P. splendida larvae present a digestive system formed with three well-differentiated segments in the intestine (anterior, middle, and posterior). The liver occupies the liver most of the anterior part of the abdominal cavity. In this regard, the maximum glut2 expression was registered at 20 dph, where P. splendida can be considered a juvenile with all its organs fully formed and functional, especially the liver, intestine, and endocrine pancreas, where pancreatic hormones including insulin, glucagon, and somatostatin are expressed (Treviño et al., 2011; Liu et al., 2014; Liang et al., 2018; Deng et al., 2020). The maximum glut2 expression was detected in P. splendida larvae at 20 dph. It can be attributed to the use of balanced feeds because their composition contains high concentrations of vegetable ingredients (up to 21% carbohydrate content), resulting in a considerable accumulation of glycogen in the liver. Although, high carbohydrate accumulation did not show histological damage (Treviño et al., 2011). Additionally, the high content of carbohydrates in diets for O. niloticus larvae is frequent since many cichlids are omnivorous species and can quickly assimilate these molecules (El-Sayed, 2006; Stickney, 2006). In contrast, P. splendida is a carnivorous fish and cannot tolerate a carbohydrate-rich diet such as other freshwater or marine carnivorous teleosts (Polakof et al., 2012; Thorens, 2015; Marandel et al., 2016).
In summary, the maximum glut2 expression in bay snook larvae occurred when organogenesis was completed (20 dph), especially in the liver and intestine. Similarly, glut2 expression in adults of P. splendida is mainly expressed in the liver and intestines to facilitate glucose absorption. Moreover, the decrease in glucose generated by gluconeogenesis and glut2 expression can be influenced by diet composition.
Acknowledgments
Gratitude to the technician Vicente Garcia Morales in charge of the DAMC teaching laboratory for his support in carrying out this research.
References
Álvarez-González C, Márquez-Couturier G, Arias-Rodríguez L, Contreras-Sánchez W, Uscanga-Martínez A, Perales-García N et al. Avances en la fisiología digestiva y nutrición de la mojarra tenguayaca Petenia splendida. In: Cruz-Suárez E, Ricque-Marie D, Tapia-Salazar M, Nieto-López MG, Villarreal-Cavazos DA, Lazo JP, Viana MT, editors. Avances en nutrición acuícola. IX Simposio Internacional de Nutrición Acuícola, Noviembre 24–27. Monterrey: Universidad Autónoma de Nuevo León; 2008. p.135–235.
Arias-Rodriguez L, Ibarra-Castro L, Páramo-Delgadillo S. Los cromosomas mitóticos y meióticos del pez tropical Petenia splendida (Cichlidae). Rev Biol Trop. 2008; 56(2):895–907. https://doi.org/10.15517/RBT.V56I2.5632
Bertrand L, Auquier J, Renguet E, Angé M, Cumps J, Horman S, Beauloye C. Glucose transporters in cardiovascular system in health and disease. Pflug Arch. 2020; 472:1385–99. https://doi.org/10.1007/s00424-020-02444-8
Blanco AM, Bertucci JI, Ramesh N, Delgado MJ, Valenciano AI, Unniappan S. Ghrelin facilitates GLUT2-, SGLT1-and SGLT2-mediated intestinal glucose transport in goldfish (Carassius auratus). Sci Rep. 2017; 7(45024):1–16. https://doi.org/10.1038/srep45024
Burggren W, Blank T. Physiological study of larval fishes: challenges and opportunities. Sci Mar. 2009; 73:99–110. https://doi.org/10.3989/scimar.2009.73s1099
Castillo J, Crespo D, Capilla E, Díaz M, Chauvigné F, Cerdà J et al. Evolutionary structural and functional conservation of an ortholog of the GLUT2 glucose transporter gene (SLC2A2) in zebrafish. Am J Physiol Regul Integr Comp Physiol. 2009; 297(5):1570–81. https://doi.org/10.1152/ajpregu.00430.2009
Cheeseman CI. Intestinal hexose absorption: transcellular or paracellular fluxes. J Physiol. 2002; 544(2):336. https://doi.org/10.1113/jphysiol.2002.029850
Darias MJ, Murray HM, Gallant JW, Astola A, Douglas SE, Yúfera M, Martínez-Rodríguez G. Characterization of a partial α-amylase clone from red porgy (Pagrus pagrus): expression during larval development. Comp Biochem Physiol B. 2006; 143(2):209–18. https://doi.org/10.1016/j.cbpb.2005.11.010
Deng D, Yan X, Zhao W, Qin C, Yang G, Nie G. Glucose transporter 2 in common carp (Cyprinus carpio L.): molecular cloning, tissue expression, and the responsiveness to glucose, insulin, and glucagon. Fish Physiol Biochem. 2020; 46:1207–18. https://doi.org/10.1007/s10695-020-00782-z
El-Sayed AF. Tilapia culture. Wallingford: CABI Publishing; 2006.
Fan H, Zhou YY, Wen HS, Zhang XY, Zhang KQ, Qi X et al. Genome-wide identification and characterization of glucose transporter (glut) genes in spotted sea bass (Lateolabrax maculatus) and their regulated hepatic expression during short-term starvation. Comp Biochem Physiol Part D Genomics Proteomics. 2019; 30:217–29. https://doi.org/10.1016/j.cbd.2019.03.007
Gómez-Zorita S, Urdampilleta A. El GLUT4: efectos de la actividad física y aspectos nutricionales en los mecanismos de captación de glucosa y sus aplicaciones en la diabetes tipo 2. Av en Diabetol. 2012; 28(1):19–26. https://doi.org/10.1016/j.avdiab.2012.02.003
Guevara M, Lodeiros C. Composición bioquímica de nauplios y metanauplios de Artemia sp. (Crustacea, Anostraca) proveniente de la salina artificial de Araya, nororiente de Venezuela. Cienc Mar. 2003; 29(4b):655–63.
Hall JR, MacCormack TJ, Barry CA, Driedzic WR. Sequence and expression of a constitutive, facilitated glucose transporter (GLUT1) in Atlantic cod Gadus morhua. J Exp Biol. 2004; 207(26):4697–706. https://doi.org/10.1242/jeb.01346
Hall JR, Richards RC, MacCormack TJ, Ewart KV, Driedzic WR. Cloning of GLUT3 cDNA from Atlantic cod (Gadus morhua) and expression of GLUT1 and GLUT3 in response to hypoxia. Biochim Biophys Acta. 2005; 1730(3):245–52. https://doi.org/10.1016/j.bbaexp.2005.07.001
Hall JR, Short CE, Driedzic WR. Sequence of Atlantic cod (Gadus morhua) GLUT4, GLUT2 and GPDH: developmental stage expression, tissue expression and relationship to starvation-induced changes in blood glucose. J Exp Biol. 2006; 209(22):4490–502. https://doi.org/10.1242/jeb.02532
Hall JR, Clow KA, Short CE, Driedzic WR. Transcript levels of class I GLUTs within individual tissues and the direct relationship between GLUT1 expression and glucose metabolism in Atlantic cod (Gadus morhua). J Comp Physiol. B. 2014; 184(4):483–96. https://doi.org/10.1007/s00360-014-0810-7
Hemre GI, Mommsen TP, Krogdahl Å. Carbohydrates in fish nutrition: effects on growth, glucose metabolism and hepatic enzymes. Aquacult Nutr. 2002; 8(4):175–94. https://doi.org/10.1046/j.1365-2095.2002.00200.x
Holman GD. Structure, function and regulation of mammalian glucose transporters of the SLC2 family. Pflugers Arch. 2020; 472:1155–75. https://doi.org/10.1007/s00424-020-02411-3
Holmberg A, Schwerte T, Pelster B, Holmgren S. Ontogeny of the gut motility control system in zebrafish Danio rerio embryos and larvae. J Exp Biol. 2004; 207(23):4085–94. https://doi.org/10.1242/jeb.01260
Jiménez-Martínez LD, Álvarez-González CA, De la Cruz-Hernández E, Tovar-Ramírez D, Galaviz MA, CamarilloCoop S et al. Partial sequence characterization and ontogenetic expression of genes involved in lipid metabolism in the tropical gar (Atractosteus tropicus). Aquac Res. 2019; 50(1):162–72. https://doi.org/10.1111/are.13879
Kamalam BS, Medale F, Panserat S. Utilisation of dietary carbohydrates in farmed fishes: new insights on influencing factors, biological limitations and future strategies. Aquaculture. 2017; 467:3–27. https://doi.org/10.1016/j.aquaculture.2016.02.007
Karim S, Adams DH, Lalor PF. Hepatic expression and cellular distribution of the glucose transporter family. World J Gastroenterol. 2012; 18(46):6771–81. https://doi.org/10.3748/wjg.v18.i46.6771
Krasnov A, Teerijoki H, Mölsä H. Rainbow trout (Onchorhynchus mykiss) hepatic glucose transporter. Biophys Acta Gene. 2001; 1520(2):174–78. https://doi.org/10.1016/S0167-4781(01)00258-5
Li R, Liu H, Dong X, Chi S, Yang Q, Zhang S, Tan B. Molecular characterization and expression analysis of glucose transporter 1 and hepatic glycolytic enzymes activities from herbivorous fish Ctenopharyngodon idellus in respond to a glucose load after the adaptation to dietary carbohydrate levels. Aquaculture. 2018; 492:290–99. https://doi.org/10.1016/j.aquaculture.2018.04.028
Liang H, Mokrani A, Chisomo-Kasiya H, Wilson-Arop OM, Mi H, Ji K, Ge X et al. Molecular characterization and identification of facilitative glucose transporter 2 (GLUT2) and its expression and of the related glycometabolism enzymes in response to different starch levels in blunt snout bream (Megalobrama amblycephala). Fish Physiol Biochem. 2018; 44(3):869–83. https://doi.org/10.1007/s10695-018-0477-1
Liu H, Wang J, Wan W, Fu P, Sun M, Wang H. Expression of glucose transporter 4 and glucose transporter 2 in different tissues of tilapia and its response to glucose injection. Chin J Anim Nutr. 2014; 26(11):3500–09.
Lubzens E, Bobe J, Young G, Sullivan CV. Maternal investment in fish oocytes and eggs: The molecular cargo and its contributions to fertility and early development. Aquaculture. 2017; 472:107–43. https://doi.org/10.1016/j.aquaculture.2016.10.029
Marandel L, Lepais O, Arbenoits E, Véron V, Dias K, Zion M et al. Remodelling of the hepatic epigenetic landscape of glucose intolerant rainbow trout (Oncorhynchus mykiss) by nutritional status and dietary carbohydrates. Sci Rep. 2016; 6(32187):1–12. https://doi.org/10.1038/srep32187
Méndez A, García ME, Lozano L. Sistemática del pez Petenia splendida (Perciformes: Cichlidae) en el lago Petén Itzá, Guatemala. Rev Biol Trop. 2011; 59(3):1205–16. https://doi.org/10.15517/rbt.v0i0.3392
Menoyo D, Diez A, Lopez-Bote CJ, Casado S, Obach A, Bautista JM. Dietary fat type affects lipid metabolism in Atlantic salmon (Salmo salar L.) and differentially regulates glucose transporter GLUT4 expression in muscle. Aquaculture. 2006; 261(1):294–304. https://doi.org/10.1016/j.aquaculture.2006.07.018
Mueckler M, Thorens B. The SLC2 (GLUT) family of membrane transporters. Mol Aspects Med. 2013; 34(2–3):121–38. https://doi.org/10.1016/j.mam.2012.07.001
Panserat S, Plagnes-Juan E, Kaushik S. Nutritional regulation and tissue specificity of gene expression for proteins involved in hepatic glucose metabolism in rainbow trout (Oncorhynchus mykiss). J Exp Biol. 2001; 204(13):2351–60. https://doi.org/10.1242/jeb.204.13.2351
Pérez-Sánchez E, Páramo-Delgadillo S. The culture of cichlids of southeastern México. Aquac Res. 2008; 39(7):777–83. https://doi.org/10.1111/j.1365-2109.2008.01929.x
Pfaffl MW. A new mathematical model for relative quantification in real-time RT–PCR. Nucleic Acids Res. 2001; 29(9):2002–07. https://doi.org/10.1093/nar/29.9.e45
Polakof S, Panserat S, Soengas JL, Moon TW. Glucose metabolism in fish: a review. J Comp Physiol B. 2012; 182:1015–45. https://doi.org/10.1007/s00360-012-0658-7
Polakof S, Skiba-Cassy S, Choubert G, Panserat S. Insulin-induced hypoglycaemia is co-ordinately regulated by liver and muscle during acute and chronic insulin stimulation in rainbow trout (Oncorhynchus mykiss). J Exp Biol. 2010; 213(9):1443–52. https://doi.org/10.1242/jeb.037689
Rodríguez-Estrada U, Méndez-Marín O, Pérez-Morales A, Martínez-García R, Peña-Marín E, Civera-Cerecedo R et al. Lipid requirement of bay snook (Petenia splendida Günther, 1862) juveniles. Lat Am J Aquat Res. 2020; 48(4):674–85. https://doi.org/10.3856/vol48-issue4-fulltext-2429
Scheepers A, Joost HG, Schurmann A. The glucose transporter families SGLT and GLUT: molecular basis of normal and aberrant function. JPEN J Parenter Enter Nutr. 2004; 28(5):364–71. https://doi.org/10.1177/0148607104028005364
Segura J, Ruilope LM. Contribución del riñón en la homeostasis de la glucosa. Med Clin. 2013; 141(Suppl. 2):26–30. https://doi.org/10.1016/S0025-7753(13)70060-5
Stickney R. Tilapia update-2005. World aquaculture. 2006; 37:18–23.
Teerijoki H, Krasnov A, Pitkanen TI, Molsa H. Cloning and characterization of glucose transporter in teleost fish rainbow trout (Oncorhynchus mykiss). Biochim Biophys Acta. 2000; 1494(3):290–94. https://doi.org/10.1016/s0167-4781(00)00216-5
Teerijoki H, Krasnov A, Gorodilov Y, Krishna S, Mölsä H. Rainbow trout glucose transporter (OnmyGLUT1): functional assessment in Xenopus laevis oocytes and expression in fish embryos. J Exp Biol. 2001a; 204(15):2667–73. https://doi.org/10.1242/jeb.204.15.2667
Teerijoki H, Krasnov A, Pitkänen TI, Mölsä H. Monosaccharide uptake in common carp (Cyprinus carpio) EPC cells is mediated by a facilitative glucose carrier. Comp Biochem Physiol B Biochem Mol Biol. 2001b; 128B(3):483–91. https://doi.org/10.1016/S1096-4959(00)00346-8
Terova G, Rimoldi S, Brambilla F, Gornati R, Bernardini G, Saroglia M. In vivo regulation of GLUT2 mRNA in sea bass (Dicentrarchus labrax) in response to acute and chronic hypoxia. Comp Biochem Physiol B Biochem Mol Biol. 2009; 152(4):306–16. https://doi.org/10.1016/j.cbpb.2008.12.011
Thorens B. GLUT2, glucose sensing and glucose homeostasis. Diabetologia. 2015; 58(2):221–32. https://doi.org/10.1007/s00125-014-3451-1
Thorens B, Mueckler M. Glucose transporters in the 21st century. Am J Physiol Endocrinol Metab. 2010; 298(2):141–45. https://doi.org/10.1152/ajpendo.00712.2009
Treviño L, Alvarez-González C, Perales-García N, Arévalo-Galán L, Uscanga-Martínez A, Márquez-Couturier G et al. A histological study of the organogenesis of the digestive system in bay snook Petenia splendida Günther, 1862 from hatching to the juvenile stage. J Appl Ichthyol. 2011; 27(1):73–82. https://doi.org/10.1111/j.1439-0426.2010.01608.x
Uscanga-Martínez A, Perales-García N, Álvarez-González CA, Moyano FJ, Tovar-Ramírez D, Gisbert G et al. Changes in digestive enzyme activity during initial ontogeny of bay snook Petenia splendida. Fish Physiol Biochem. 2011; 37(3):667–80. https://doi.org/10.1007/s10695-011-9467-2
Vidal-López JM, Álvarez-González CA, Contreras-Sánchez WM, Hernández-Vidal U. Masculinización del cíclido nativo Tenhuayaca, Petenia splendida (Günther, 1862), usando nauplios de Artemia como vehículo del esteroide 17-α metiltestosterona. Hidrobiológica. 2009; 19(3):211–16.
Wang E, Wang K, Chen D, Wang J, He Y, Long B et al. Evaluation and selection of appropriate reference genes for real-time quantitative PCR analysis of gene expression in Nile tilapia (Oreochromis niloticus) during vaccination and infection. Int J Mol Sci. 2015; 16(5):9998–10015. https://doi.org/10.3390/ijms16059998
Wood IS, Trayhurn P. Glucose transporters (GLUT and SGLT): expanded families of sugar transport proteins. Br J Nutr. 2003; 89(1):3–09. https://doi.org/10.1079/BJN2002763
Wright JR, Jr., O’Hali W, Yang H, Han XX, Bonen A. GLUT-4 deficiency and severe peripheral resistance to insulin in the teleost fish tilapia. Gen Comp Endocrinol. 1998; 111(1):20–27. https://doi.org/10.1006/gcen.1998.7081
Yan N. A glimpse of membrane transport through structures advances in the structural biology of the GLUT glucose transporters. J Mol Biol. 2017; 429(17):2710–25. https://doi.org/10.1016/j.jmb.2017.07.009
Yang H, Garzel B, Heyward S, Moeller T, Shapiro P, Wang H. Metformin represses drug-induced expression of CYP2B6 by modulating the constitutive androstane receptor signaling. Mol Pharmacol. 2013; 85(2):249–60. https://doi.org/10.1124/mol.113.089763
Ye G, Zhang W, Dong X, Tan B, Zhang S. Effects of acute hyperglycaemia stress on indices of glucose metabolism and glucose transporter genes expression in cobia (Rachycentron canadum). Aquac Res. 2020; 51(2):584–94. https://doi.org/10.1111/are.14405
Zhang Z, Wu RSS, Mok HOL, Wang Y, Poon WWL, Cheng SH et al. Isolation, characterization and expression analysis of a hypoxia-responsive glucose transporter gene from the grass carp, Ctenopharyngodon idellus. Eur J Biochem. 2003; 270(14):3010–17. https://doi.org/10.1046/j.1432-1033.2003.03678.x
Zhao W, Qin C, Yang G, Yan X, Meng X, Yang L et al. Expression of glut2 in response to glucose load, insulin and glucagon in grass carp (Ctenopharyngodon idellus). Comp Biochem Physiol B Biochem Mol Biol. 2020; 239:110351. https://doi.org/10.1016/j.cbpb.2019.110351
Authors
Alejandra del Carmen Castillo-Collado1, Carlos Alfonso Frías-Quintana2, Vicente Morales-Garcia3, Carina Shianya Alvarez-Villagomez4, Gloria Asencio-Alcudia4, Emyr Saul Peña-Marín4,5, Gil Martínez-Bautista6, Luis Daniel Jiménez-Martinez1 and Carlos Alfonso Álvarez-González4
[1] Laboratorio de Biologia Molecular. DAMJM-UJAT, Jalpa de Mendez, Tabasco, México. (ACCC) 162S1053@egresados.ujat.mx, (LDJM) luisd1984@hotmail.com (corresponding author).
[2] Laboratorio de Investigación en Biotecnología Acuícola (LIBA), Tecnológico Nacional de México. Campus Boca del Río (ITBoca),Boca del Río, Veracruz, Mexico. (CAFQ) cafq22@hotmail.com.
[3] Laboratorio de Docencia DAMC-UJAT, Ranchería Sur Cuarta Sección, Comalcalco, Mexico. (VMG) almostmaster@live.com.mx.
[4] Laboratorio de Fisiología en Recursos Acuáticos, DACBIOL-UJAT, Villahermosa, México. (CSAV) carina.alvarez@Ujat.mx, (GAA) yoya_asencio@live.com.mx, (ESPM) ocemyr@yahoo.com.mx, (CAAG) alvarez_alfonso@hotmail.com.
[5] Cátedra-CONACyT-DACBiol-UJAT. Av. Crédito Constructor, CDMX, Mexico.
[6] Developmental Physiology Laboratory, Developmental Integrative Biology Research Group, Department of Biological Sciences,University of North Texas, Denton, TX 76203-5017, USA. (GMB) gil.martinezbautista@unt.edu.
